Lab Reagents
Bps Bioscience Laboratories manufactures the sds bps bioscience reagents distributed by Genprice. The Sds Bps Bioscience reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Bps Bioscience. Other Sds products are available in stock. Specificity: Sds Category: Bps Group: Bioscience
Bioscience information
SDS siRNA |
|
20-abx932743 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SDS siRNA |
|
20-abx932744 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SDS |
|
YF-PA17352 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to SDS |
dAbs scaffold protein anti-Human B5R |
|
SDS-L073 |
Creative Biolabs |
1 mg |
EUR 4496 |
|
Description: Scaffold protein |
TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution |
|
A0030 |
Bio Basic |
4L |
EUR 94.8 |
- Product category: Biochemicals/Biological Buffers/Common Buffers
|
TT-SDS (Tris-Tricine-SDS buffer) Premix powder |
|
TD8135 |
Bio Basic |
1PK, 10L |
EUR 76.1 |
- Product category: Biochemicals/Biological Buffers/Common Buffers
|
TG-SDS, 10X (Tris-Glycine SDS), pH 8.4 |
|
UA0030 |
Bio Basic |
500ml |
EUR 67.4 |
- Product category: Biochemicals/Biological Buffers/Common Buffers
|
SDS Polyclonal Antibody |
|
27842-100ul |
SAB |
100ul |
EUR 252 |
SDS Polyclonal Antibody |
|
27842-50ul |
SAB |
50ul |
EUR 187 |
SDS Rabbit pAb |
|
A12898-100ul |
Abclonal |
100 ul |
EUR 308 |
SDS Rabbit pAb |
|
A12898-200ul |
Abclonal |
200 ul |
EUR 459 |
SDS Rabbit pAb |
|
A12898-20ul |
Abclonal |
20 ul |
EUR 183 |
SDS Rabbit pAb |
|
A12898-50ul |
Abclonal |
50 ul |
EUR 223 |
SDS Blocking Peptide |
|
33R-4446 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762 |
SDS Blocking Peptide |
|
33R-1011 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399 |
SDS cloning plasmid |
|
CSB-CL020926HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 657
- Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
- Show more
|
|
Description: A cloning plasmid for the SDS gene. |
