Home » Klhl12 Disheveled Binding Assay

Klhl12 Disheveled Binding Assay

Lab Reagents

Binding Assay Laboratories manufactures the klhl12 disheveled binding assay reagents distributed by Genprice. The Klhl12 Disheveled Binding Assay reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact binding assay. Other Klhl12 products are available in stock. Specificity: Klhl12 Category: Disheveled Group: Binding Assay

Binding Assay information

pOTB7-KLHL12
PVT18492 2 ug
EUR 231

Klhl12 Blocking Peptide
33R-2002 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Klhl12 antibody, catalog no. 70R-8364

KLHL12 Conjugated Antibody
C46592 100ul
EUR 397

KLHL12 Blocking Peptide
BF0473-BP 1mg
EUR 195

KLHL12 cloning plasmid
CSB-CL700650HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1707
  • Sequence: atgggaggcattatggcccccaaagacataatgacaaatactcatgctaaatccatcctcaattcaatgaactccctcaggaagagcaataccctctgtgatgtgacattgagagtagagcagaaagacttccctgcccatcggattgtgctggctgcctgtagtgattacttct
  • Show more
Description: A cloning plasmid for the KLHL12 gene.

KLHL12 Polyclonal Antibody
A59562 100 µg
EUR 570.55
Description: kits suitable for this type of research

KLHL12 Rabbit pAb
A4906-100ul 100 ul
EUR 308

KLHL12 Rabbit pAb
A4906-200ul 200 ul
EUR 459

KLHL12 Rabbit pAb
A4906-20ul 20 ul Ask for price

KLHL12 Rabbit pAb
A4906-50ul 50 ul Ask for price

anti- KLHL12 antibody
FNab04610 100µg
EUR 505.25
  • Immunogen: kelch-like 12(Drosophila)
  • Uniprot ID: Q53G59
  • Gene ID: 59349
  • Research Area: Metabolism
Description: Antibody raised against KLHL12

anti-KLHL12 (2G2)
LF-MA30411 100 ul
EUR 486
Description: Mouse Monoclonal to KLHL12

Anti-KLHL12 antibody
PAab04610 100 ug
EUR 355

pENTR223-KLHL12 vector
PVT11800 2 ug
EUR 304

Anti-KLHL12 antibody
STJ26949 100 µl
EUR 277
Description: This gene encodes a member of the KLHL (Kelch-like) family of proteins. This protein has been identified as an autoantigen in the autoimmune disease Sjogren's syndrome and as a potential biomarker in primary biliary cirrhosis. This protein may act as a substrate adaptor of the Cullin-3 ubiquitin ligase complex to promote substrate-specific ubiquitylation. Ubiquitylation by this complex has been shown to regulate the Wnt signaling pathway as well as COPII vesicle coat size. A pseudogene has been identified on chromosome 22. Alternative splicing results in multiple transcript variants.

Anti-KLHL12 antibody
STJ98202 100 µl
EUR 234
Description: Mouse monoclonal to KLHL12.

Retinol Binding Protein Assay Kit
abx098452-Hitachi7060R130ml2R220ml1 Hitachi 7060; R1 30ml×2 R2 20ml×1
EUR 504
  • Shipped within 5-12 working days.