Lab Reagents
Binding Assay Laboratories manufactures the klhl12 disheveled binding assay reagents distributed by Genprice. The Klhl12 Disheveled Binding Assay reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact binding assay. Other Klhl12 products are available in stock. Specificity: Klhl12 Category: Disheveled Group: Binding Assay
Binding Assay information
Klhl12 Blocking Peptide |
33R-2002 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Klhl12 antibody, catalog no. 70R-8364 |
KLHL12 Conjugated Antibody |
C46592 |
SAB |
100ul |
EUR 397 |
KLHL12 Blocking Peptide |
BF0473-BP |
Affbiotech |
1mg |
EUR 195 |
KLHL12 cloning plasmid |
CSB-CL700650HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1707
- Sequence: atgggaggcattatggcccccaaagacataatgacaaatactcatgctaaatccatcctcaattcaatgaactccctcaggaagagcaataccctctgtgatgtgacattgagagtagagcagaaagacttccctgcccatcggattgtgctggctgcctgtagtgattacttct
- Show more
|
Description: A cloning plasmid for the KLHL12 gene. |
KLHL12 Polyclonal Antibody |
A59562 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
KLHL12 Rabbit pAb |
A4906-100ul |
Abclonal |
100 ul |
EUR 308 |
KLHL12 Rabbit pAb |
A4906-200ul |
Abclonal |
200 ul |
EUR 459 |
KLHL12 Rabbit pAb |
A4906-20ul |
Abclonal |
20 ul |
Ask for price |
KLHL12 Rabbit pAb |
A4906-50ul |
Abclonal |
50 ul |
Ask for price |
anti- KLHL12 antibody |
FNab04610 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: kelch-like 12(Drosophila)
- Uniprot ID: Q53G59
- Gene ID: 59349
- Research Area: Metabolism
|
Description: Antibody raised against KLHL12 |
anti-KLHL12 (2G2) |
LF-MA30411 |
Abfrontier |
100 ul |
EUR 486 |
Description: Mouse Monoclonal to KLHL12 |
Anti-KLHL12 antibody |
STJ26949 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the KLHL (Kelch-like) family of proteins. This protein has been identified as an autoantigen in the autoimmune disease Sjogren's syndrome and as a potential biomarker in primary biliary cirrhosis. This protein may act as a substrate adaptor of the Cullin-3 ubiquitin ligase complex to promote substrate-specific ubiquitylation. Ubiquitylation by this complex has been shown to regulate the Wnt signaling pathway as well as COPII vesicle coat size. A pseudogene has been identified on chromosome 22. Alternative splicing results in multiple transcript variants. |
Anti-KLHL12 antibody |
STJ98202 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to KLHL12. |
Retinol Binding Protein Assay Kit |
abx098452-Hitachi7060R130ml2R220ml1 |
Abbexa |
Hitachi 7060; R1 30ml×2 R2 20ml×1 |
EUR 504 |
- Shipped within 5-12 working days.
|