Aviva Systems Biology Ch25H

CH25H ELISA Kit (Human) (OKCD01912)

OKCD01912 96 Wells
EUR 831
Description: Description of target: Catalyzes the formation of 25-hydroxycholesterol from cholesterol, leading to repress cholesterol biosynthetic enzymes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 49 pg/mL

Aviva Systems Biology Laboratories manufactures the aviva systems biology ch25h reagents distributed by Genprice. The Aviva Systems Biology Ch25H reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Aviva Systems Biology. Other Aviva products are available in stock. Specificity: Aviva Category: Systems Group: Biology Ch25H

Biology Ch25H information

CH25H siRNA

20-abx901026
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CH25H siRNA

20-abx911626
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CH25H siRNA

20-abx911627
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CH25H

YF-PA25249 50 ul
EUR 334
Description: Mouse polyclonal to CH25H

CH25H cloning plasmid

CSB-CL005307HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctgttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga
  • Show more
Description: A cloning plasmid for the CH25H gene.

CH25H cloning plasmid

CSB-CL005307HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctcttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga
  • Show more
Description: A cloning plasmid for the CH25H gene.

Anti-CH25H (1G8)

YF-MA16625 100 ug
EUR 363
Description: Mouse monoclonal to CH25H

BCIP (Molecular Biology Grade)

CE108 250 mg
EUR 63

BCIP (Molecular Biology Grade)

CE109 1 g
EUR 90

CHAPS (Molecular Biology Grade)

CE114 1 g
EUR 55

CHAPS (Molecular Biology Grade)

CE115 5 g
EUR 131

CHAPS (Molecular Biology Grade)

CE116 25 g
EUR 410

DAPI (Molecular Biology Grade)

CE117 5 mg
EUR 60

DAPI (Molecular Biology Grade)

CE118 25 mg
EUR 133

DAPI (Molecular Biology Grade)

CE119 100 mg
EUR 319

Dimethylsulfoxide (Molecular Biology Grade)

CE120 100 ml
EUR 55

Dimethylsulfoxide (Molecular Biology Grade)

CE121 500 ml
EUR 92