Lab Reagents
Beadblaster Laboratories manufactures the napa bead blaster reagents distributed by Genprice. The Napa Bead Blaster reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Beadblaster. Other Napa products are available in stock. Specificity: Napa Category: Bead Group: Blaster
Blaster information
NAPA siRNA |
|
20-abx925400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NAPA siRNA |
|
20-abx925401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Micro Bead Sterlizer |
|
B1201-E |
BenchMark |
1 PC |
EUR 542.7 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Micro Bead Sterlizer |
|
B1202-E |
BenchMark |
1 PC |
EUR 84.14 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Refill Glass Beads |
|
B1201-BEAD |
BenchMark |
1 PC |
EUR 117.78 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
NAPA Blocking Peptide |
|
33R-5853 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAPA antibody, catalog no. 20R-1339 |
NAPA Conjugated Antibody |
|
C31126 |
SAB |
100ul |
EUR 397 |
NAPA cloning plasmid |
|
CSB-CL015447HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 888
- Sequence: atggacaattccgggaaggaagcggaggcgatggcgctgttggccgaggcggagcgcaaagtgaagaactcgcagtccttcttctctggcctctttggaggctcatccaaaatagaggaagcatgcgaaatctacgccagagcagcaaacatgttcaaaatggccaaaaactggag
- Show more
|
|
Description: A cloning plasmid for the NAPA gene. |
NAPA Polyclonal Antibody |
|
A59986 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
NAPA Rabbit pAb |
|
A7946-100ul |
Abclonal |
100 ul |
EUR 308 |
NAPA Rabbit pAb |
|
A7946-200ul |
Abclonal |
200 ul |
EUR 459 |
NAPA Rabbit pAb |
|
A7946-20ul |
Abclonal |
20 ul |
EUR 183 |
NAPA Rabbit pAb |
|
A7946-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-NAPA antibody |
|
STJ110255 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene. |
Bangs Lab Bead Solution |
|
SOLN1-1000 |
Bangs Laboratories |
1000 ML |
EUR 155.06 |
|
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres |
Bangs Lab Bead Solution |
|
SOLN1-2000 |
Bangs Laboratories |
2000 ML |
EUR 212.7 |
|
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres |
