Napa Bead Blaster

Lab Reagents

Beadblaster Laboratories manufactures the napa bead blaster reagents distributed by Genprice. The Napa Bead Blaster reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Beadblaster. Other Napa products are available in stock. Specificity: Napa Category: Bead Group: Blaster

Blaster information

NAPA siRNA

20-abx925400
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPA siRNA

20-abx925401
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Micro Bead Sterlizer

B1201-E 1 PC
EUR 542.7
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Micro Bead Sterlizer

B1202-E 1 PC
EUR 84.14
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Refill Glass Beads

B1201-BEAD 1 PC
EUR 117.78
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

NAPA Blocking Peptide

33R-5853 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAPA antibody, catalog no. 20R-1339

NAPA Conjugated Antibody

C31126 100ul
EUR 397

NAPA cloning plasmid

CSB-CL015447HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggacaattccgggaaggaagcggaggcgatggcgctgttggccgaggcggagcgcaaagtgaagaactcgcagtccttcttctctggcctctttggaggctcatccaaaatagaggaagcatgcgaaatctacgccagagcagcaaacatgttcaaaatggccaaaaactggag
  • Show more
Description: A cloning plasmid for the NAPA gene.

NAPA Polyclonal Antibody

A59986 100 µg
EUR 570.55
Description: kits suitable for this type of research

NAPA Rabbit pAb

A7946-100ul 100 ul
EUR 308

NAPA Rabbit pAb

A7946-200ul 200 ul
EUR 459

NAPA Rabbit pAb

A7946-20ul 20 ul
EUR 183

NAPA Rabbit pAb

A7946-50ul 50 ul
EUR 223

Anti-NAPA antibody

STJ110255 100 µl
EUR 277
Description: This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene.

Anti-NAPA Antibody

STJ503074 100 µg
EUR 476

Bangs Lab Bead Solution

SOLN1-1000 1000 ML
EUR 155.06
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres

Bangs Lab Bead Solution

SOLN1-2000 2000 ML
EUR 212.7
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres